Fine Biotech is an ISO9001:2008 Certified Company,offers a full line of quality research kits,which include ELISA Kits,related ELISA assistant reagents and more high quality antibodies, recombinant proteins. Fine Biotech technical support are delicated to providing with professional and friendly assistance for our customers. Strict and multiple quality control ensure that our products continue to successfully supply for the international market. Moreover, we strive to continuously improve the customer experience through comprehensive technical support. High quality,rapid turnaround and personal support for all FineTest services are guaranteed. Should you have any problems,or any ideas on ways that we can improve our service,please feel free to call upon us.Thank you for your interest in FineTest products and we look forward to supplying you in the near future.
About BIOPREMIER PRODUCING & DEVELOPING YOUR KIT SOLUTIONS A spin-off company from BIOPREMIER SA (currently SGS Molecular), founded in 2016 to become an innovation driver for products in molecular biology. Despite the young age we gather over 20 years of experience in molecular biology solution. Our clients are laboratories, private or government owned, that need high quality kit solutions or support in building up their molecular biology portfolio. - We are constantly developing new kits and updating our current portfolio. Our current catalogue has over 60 kits for food targets. We also develop kits upon request by our clients, with short development times. - We control the whole process, from designing the solution to producing the kits. Our VISION BPMR wants to become a global reference in producing and developing kits for diagnostics' laboratories, in particular for real time PCR detection kits, supported by its technical know-how, by its innovative capability and solutions presented to its clients.
Cells cultured in vitro on substrates of physiological rigidity were documented to resemble physiology of cells in vivomuch better than cells grown on flat plastic surfaces of traditional tissue culture plates. Softsubstrates™ plates are our simple and elegant tools to culture cells on substrates of defined rigidities. On the bottom of each well is a thin layer of specially formulated biocompatible elastomer which rigidity is measured and certified for producing successful repeat experiments. Advantages of our SoftSubstrates™ Cell Culture Products: 
GlycoSeLect Ltd specializes in the development and production of Recombinant Prokaryotic Lectins (RPLs).
EFHC2 CSB-CL705512HU
Specifications
| 10 μg plasmid + 200μl Glycerol |
Accession nr:
BC031039
Gene ID:
80258
Vector:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence:
atggccctgcctctgctgccgggcaacagcttcaaccgcaacgtgggaaaggagaagtttcacaaatcccaacattggggcttttgcaacaatgttatgatgttggtgagtgatgaaaagcctggaataggtggagaaccacttctggggcaaaagataaagcctaaatgtagcatatatcctaaaggagatggaagtgatgtaccatcatgggtagcctttgataaacaggtattatcttttgatgcctatttggaagaggaagtacttgataaaagccaaaccaactacagaataagatactataaaatctacttctaccctgaagatgacacaattcaagtaaatgaaccagaggtgaaaaatagtggattacttcaagggacttctatccggcgtcatcggattactcttccgcctcctgatgaggatcagttttatactgtgtatcattttaatgtcggcacagaggttgtcttctatggccggacattcaagatttatgactgtgatgcattcacaagaaactttttgaggaaaataggggtcaaagtgaatcccccagtgcaatgtccagaagatccttacatgaagattcggagagaggttgtagaacacgtagagcccttacgtccctacgaatccctcgacaccctgaaacagttcctccagtatcatggcaagattttgtgtttcttctgcctgtgggatgactcagtctcaatgtttggagaccgtagagaactcatcctgcattacttcttgtgtgatgatactattgaaatcaaagaattgcttccacacagctcaggccgagatgctctaaaaatgttcctccggaggagtaagctacccaagaattgcccacctagagtctatcaaccaggccagataacagatcgagcagttctcaattcatatggtgactttataaagaaccaagcggatggctacctgttcgatagatataagctaggaaaagtagaccaagagttttacaaagatagtgacctgtccctaggagtcaccatcaatgtgtggggaagaaaagtgctcctttatgactgtgatgaatttacgaagtcttattataagtctaaatatggaattgagaactttacctcagtttcatgcaagcctccttctcctcctccaaaaatagaaaggaaatttccaccttacaacggttttggttctgaagaggattctctccgtaactgcatagacctcaagcccacacctcatcggaggaacttcaagaagtttatggaaaaagacagctatggctccaaaagcaatatactccgtttttttgcaaaactagtcacagacaaatgtgttgacttggacaggatgtttgttatttcatattatctcggtgatgacaccatttcagtgtttgaacctatagagaggaattcaggaattgctggtgggatgttcttgaaaagaagtcgcgttaagaagcctggacaagaagtctttaaaagtgaactatctgaatatatcaaggccgaggagctgtacattggagtcacggtgaatgtgaatggttacctatttcgtttgctcaatgctgatgagtataccttaaactacatggagcagaatacagataagtatcctttcagtaacctcaaacttgccctacaaaagctgaagcaagaagaaggaaaatccagagagctcaagcaggtatttaaagctgctgactctaagcacacaaatatggtggattataatacattcagagacatattgatgtctttgactgttggaaaccttgcagagcaagaatttgtaaccattgcacgtcactaccgtgtgcctgagggcacatgttcagatatggatttcttaatcgcactggcccacgaaaagttcaagaaaaatatgtttgagaatttcgacactttcatttattcctgtgtgtatgaagatcgagaaaaaaaaaatgtattacccaccaaagacattaaaaggctgtgcaaatcctccagattacctttgagtgatgatcttctagaatccttattgtcaaggtttgaagacagtgaaaaacaaatagattataagtcatttttctctgccctgaactggagaaagaatccagtgcctgaattgcaaccagcatcataccttaaagagagatgtgaagatgtttggcttggtatgccatcacctattcctgcgaaatacattgactactggacctttttgaaggacgcgtttggcttagaggaggaataa
Length:
2250