Skip to main content

Sinopeg

sinopegSINOPEG is a dynamic science company dedicated to drug delivery systems (DDS). As a leading company in polyethylene glycol derivatives (PEGs), they are also specialized in the R&D of long acting biopharmaceuticals, developing and manufacturing of block copolymers, lipids for drug delivery, medical devices, bio-engineering, and other broad uses.

With proprietary technologies and state-of-the-art GMP standard manufacturing capability, SINOPEG is capable of supplying small to large quantities of rich selection of PEG derivative products with unique molecular designs (chemical structure, molecular weights (MW)) and exceptional product quality control to serve bio-technology and pharmaceutical companies and research organizations worldwide.

SINOPEG is a proud collaborator with a number of well-known universities, research institutes, and pharmaceutical and biotech companies around the globe.


SINOPEG’s Advantages:
    •    SINOPEG has 24+ patents on PEG Derivatives and Pegylated Drugs.
    •    ISO-9001and ISO-13485 certified.
    •    Multiple Drugs Master File（DMF）submissions.

Certificate Of Analysis (COA)
COAs will be provided for all products ordered from SINOPEG.

Special Customization
SINOPEG is able to customize a wide range of PEG products from mg to kg, and our products can meet the specific requirements of customers.

www.sinopeg.com

The prices are on request! Contact Us by e-mail info@sobekbio.com

TissueClick

tissueclick“Leading the way in the research and production of 3D cell culture solutions”

Who are they?
Tissue Click has a young, innovative, research-led company that designs, develops and creates novel solutions to tissue culture limitations to meet your research needs.

What is Tissue Click’s mission?
Tissue Click’s mission is to provide bespoke products that allow our customers to fully exploit the in-vitro culture of cells in applications related to regenerative medicine, diseases such as cancer and diabetes, in-vitro drug screening and for incorporation into bioinks.

What is different about their products?
• Tissue Click PhenoDrive products promote the formation of 3D cell spheroids from 2D culture systems without need for gels.
• PhenoDrives are animal component free and are provided as lyophilised powders that are easily reconstituted and incorporated into your existing protocols.
• PhenoDrives are a range of fully synthetic, biomimetic materials to provide simple, single step solutions to promote your cell culture models and preserve phenotype through mimicry of the extracellular matrix.
• Nanosperse allows the simple dispersal of nanoparticles for individual testing and study

www.tissueclick.com/

The prices are on request! Contact Us by e-mail info@sobekbio.com

Croyez Bioscience

croyezbioscince"Croyez"  specializes in bringing scientists "absolute solution" products for all applications of the protein research area. They offer recombinant protein GMP and RUO grade, mRNA synthesis raw material, Molecular Diagnosis raw material, Allergen raw material, COVID -19 antibody and antigen and Later flow products. Every tool you need to fulfill your research experiment in the protein area, Croyez has relevant products to offer. They also provide CRO/CDMO service, customize protein production, customize monoclonal antibody production, customize immunoassay platform and Diagnosis platform development.

Croyez has a professional team with a high passion to provide the best tools to researchers all around the world.

www.croyezbioscience.com

The prices are on request! Contact Us by e-mail info@sobekbio.com

CUSABIO

cusabio

CUSABIO is a National High-Tech Enterprise which combines research, production and sales in one. They are dedicated to providing 60,000+ validated antibodies, 8,000+ recombinant proteins, 660+ cytokines and thousands of ELISA kits to global customers in the research fields of cancer, cell biology, immunology, neuroscience, epigenetics, etc. 

What CUSABIO Does:

As a manufacturer of ELISA kits, Exosome isolation kits, antibodies, proteins and related reagents, their only mission is to provide the best products and related custom service to researchers so that they can have a good start for the next breakthrough. CUSABIO's high quality has been guaranteed by many published literatures in all kinds of famous journals, such as Science, Nature, Cell, Developmental Biology, Molecular Cell, Genes & Development, and so on. Now, the publications citing CUSABIO products has reached more than 4,800, with hundreds of publications updating every year.

Kits

CUSABIO has a sound platform for the development of assay kits, mature antigen-antibody research and development systems. Assay kits offered by CASABIO are mainly two types, including ELISA kits and exosome isolation kits. They are proficient in a variety of ELISA technologies such as the double antibody sandwich method, double antigen sandwich method, direct competition ELISA method, indirect competition ELISA blocking method, indirect ELISA method, and other methods. And fine affinity purification technology for the production of Exosome Isolation Kits is also adopted.

Combined with their diagnostic kits development team, CUSABIO is able to develop ELISA kits with clinical diagnostic levels and make the quality in the leading place worldwide. Exosomes have been one of the research hotspots in recent years, and the separation technology of exosomes has been constantly updated and improved. After continuous improvement and repeated testing, CUSABIO has also developed high purity, high yield, and high-efficiency exosome isolation kits. CUSABIO now offers a broad range of ELISA kits covering over 6,000 different assay targets and two Cell Supernatant Exosome Isolation Kits.

Antibodies

CUSABIO offers 60,000+ antibodies that are specific to a variety of species and can be used in multiple applications. Furthermore, the number of CUSABIO antibodies is continuing to grow at a rate of 1000 per year.

As an original manufacturer, CUSABIO designs, produces and validates every antibody in-house. Besides advanced experimental apparatus, CUSABIO antibody line also has a professional technical team, so CUSABIO has succeeded in setting up many technology platforms. At present CUSABIO antibodies can be applied in ELISA, WB, IHC/ICC, IF, IP/Co-IP, ChIP and FC. 

Proteins

CUSABIO Protein Expression Platform has established four recombinant expression systems from prokaryotic (E.coli) to eukaryotic (Yeast, mammalian cell and insect baculovirus), and has also built unique in-vitro E.coil expression system, which enables them to express transmembrane proteins that are usually difficult to express.

CUSABIO currently has 70 native proteins, 100 small molecule antigens, 320 active proteins, 1000+ recombinant proteins in stock, 5700+ developed recombinant proteins, 10,000+ cDNA clones, 36,000+ transmembrane proteins, 500,000+ semi-customized recombinant proteins. 

Custom Service

Given the specificity of each experiment, CUSABIO provides the latest and comprehensive custom services to meet their customers request, including phage display service, antibody service, protein service, gene synthesis service and oligo synthesis service. CUSABIO is very pleased to assist their customers worldwide with all passions and great efforts.

www.cusabio.com

The prices are on request! Contact Us by e-mail info@sobekbio.com

Reed Biotech

reed_biotech

Reed Biotech Ltd is a high-tech biological company,  focusing on the field of biological immune protein research. They firmly believe in the philosophy of cyclic symbiosis between human and nature, and integrate it into our business and products. Reed Biotech are committed to providing high-quality reagents and solutions for the global scientific research and medical industry, to promote the harmonious development of human and nature.

Reed Biotech® antibody line covers a variety of animal-derived second antibodies and polyclonal antibodies, Reed also provides customized services based on monoclonal antibodies. Their ELISA includes various types of immunoassay kits for human, mouse, rat and other species, covering a variety of detection indicators. Additionally Reed’s biochemical analysis comprises an assortment of enzyme-linked immunoassay (ELISA) reagents, enzyme labeling reagents, chromogenic substrates, etc., which can meet customers' needs for the detection of various biomolecules. Their recombinant protein line includes proteins from various species, such as human, mouse, and rat. And Reed’s immune-related reagents cover a variety of cytokines, cytokine receptors, signaling pathways, etc. Reed Biotech has strict quality control in their products, all out-of-warehouse items must pass the GMP standard and ISO: 9001 to ensure products’ stability.

These products play an important role in the field of biomedical research. Reed Biotech focuses on the quality and sustainability of the products, striving to reduce the impact on the environment, and actively participate in ecological conservation and sustainable development initiatives. In their R&D and production processes, Reed has adopted advanced technologies and methods to minimize the consumption and pollution of natural resources. They strictly control the products production process to ensure the compliance of pro-environment, and actively promote greening production. Reed is actively conducting research to find environmentally-friendly and sustainable alternatives for our customers.

www.reedbiotech.com

The prices are on request! Contact Us by e-mail info@sobekbio.com

BBS2 CSB-CL866303HU



The add to cart button will appear once you select the values above

Specifications

10 μg plasmid + 200μl Glycerol

Accession nr:

BC014140

Gene ID:

583

Vector:

Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence:

atgctgctgcctgtgttcaccctgaaactgcgccacaaaatcagcccccgaatggtggccatagggcgctacgacgggactcacccgtgcctggcggccgccacccaaacgggcaaggtttttattcataatcctcatacacggaaccagcatgtcagtgcatccagggtcttccagagccccctggaatctgatgtttctcttctcaacattaaccaggcagtcagctgtctgactgcaggcgtattgaaccctgagcttggctatgatgcccttttagtggggacacagactaatcttttggcttatgatgtctacaataattcggatttgttctacagagaggtagcagatggggcaaatgtagttgtgctggggacattgggagacatttcttcccctcttgcgattattggtggcaattgtgctctgcaaggtttcaatcatgaaggaagtgatctcttttggacggttactggagacaatgttaattccttggccttgtgtgactttgatggtgatggaaagaaagagcttcttgttggatctgaggattttgatatccgagtttttaaggaagatgagattgtggcagaaatgacagaaacagagatagtcacctctctttgtcccatgtatggcagtcgatttggttatgccctttccaatggcacagttggagtttatgacaaaacatcccgatactggagaattaaatcgaaaaatcatgccatgagcattcatgcttttgaccttaattctgatggagtgaatgaactgataactggttggtccaatgggaaggttgatgctcgaagtgaccgaactggggaggtcatctttaaggacaatttttcttctgcaattgccggtgtggtagagggagattaccggatggatggccacatacagttaatctgctgctcagtggatggggaaatccggggctacctgcctggcacggctgagatgaggggcaacctcatggacaccagtgcagagcaggacctgatccgagagctgagtcagaagaagcagaatctgttgctggaactccgtaactatgaggaaaatgccaaggctgaattggccagtccactgaacgaggctgatgggcatcggggcataatcccagccaataccaggctccacaccacgctctcagtcagcctggggaatgagacccaaactgctcatacagaattacgcatttccacttctaatgacaccatcatccgagcagtattgatttttgcagaaggaatttttacaggtgaaagccacgtggtacatcccagcattcacaacctctccagttccatctgcatccctattgtgcctcccaaagatgtccctgtggatctgcacttgaaggcattcgtgggttacagaagcagcacccagtttcatgtatttgaatcgacaagacagctccctcgattctccatgtatgcgctgaccagcctggaccctgccagtgagccaatcagttatgttaactttaccattgcagaacgggcacagagggttgttgtatggctcggtcagaactttctgttaccagaagacactcacattcagaatgctccatttcaagtgtgtttcacatctttacggaatggcggccacctgcatataaaaataaaacttagtggagagatcactataaatactgatgatattgatttggctggtgatatcatccagtcaatggcatcattttttgctattgaagaccttcaagtagaagcggattttcctgtctattttgaggaattacgaaaggtgctagttaaggtggatgaatatcattcagtgcatcagaagctcagtgctgatatggctgatcattctaatttgatccgaagtttgctggtcggagctgaggatgctcgtctgatgagggacatgaaaacaatgaagagtcgttatatggaactctatgaccttaatagagacttgctaaatggatataaaattcgctgtaacaatcacacagagctgttgggaaacctcaaagcagtaaatcaagcaattcaaagagcaggtcgtctgcgggttggaaaaccaaagaaccaggtgatcactgcttgtcgggatgcaattcgaagcaataacatcaacacactgttcaaaatcatgcgagtggggacagcttcttcctag

Length:

2166