Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

CD349 Recombinant Protein NCP0300

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

CTGGAAATTGGTCGCTTCGATCCGGAACGTGGCCGTGGTGCCGCCCCTTGTCAGGCAGTTGAAATTCCGATGTGCCGTGGTATTGGTTATAATCTGACCCGCATGCCGAATCTGCTGGGCCATACCAGTCAGGGCGAAGCAGCCGCCGAACTGGCAGAATTCGCCCCGCTGGTTCAGTATGGTTGCCATAGCCATCTGCGCTTCTTCCTGTGTAGCCTGTATGCCCCGATGTGCACCGATCAGGTTAGCACCCCGATTCCGGCATGTCGCCCGATGTGCGAACAGGCACGCCTGCGCTGTGCACCGATTATGGAACAGTTCAACTTCGGTTGGCCGGATAGTCTGGATTGTGCCCGCCTGCCGACCCGCAATGATCCGCATGCACTGTGCATGGAAGCACCGGAAAATGCCACCGCCGGCCCGGCTGAACCGCATAAAGGTCTGGGCATGCTGCCGGTGGCACCGCGTCCTGCACGTCCTCCTGGTGATCTGGGTCCGGGTGCAGGTGGTAGTGGCACCTGTGAAAATCCGGAAAAATTCCAGTATGTGGAAAAAAGCCGTAGCTGTGCACCGCGCTGCGGCCCTGGTGTGGAAGTGTTCTGGAGCCGCCGTGATAAAGAT

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~28kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

Receptor for WNT2 that is coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes. Plays a role in neuromuscular junction (NMJ) assembly by negatively regulating the clustering of acetylcholine receptors (AChR) through the beta-catenin canonical signaling pathway. May play a role in neural progenitor cells (NPCs) viability through the beta-catenin canonical signaling pathway by negatively regulating cell cycle arrest leading to inhibition of neuron apoptotic process. During hippocampal development, regulates neuroblast proliferation and apoptotic cell death. Controls bone formation through non canonical Wnt signaling mediated via ISG15. Positively regulates bone regeneration through non canonical Wnt signaling (By similarity).

Note:

For research use only, not for use in diagnostic procedure.