Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

CD144 Recombinant Protein NCP0269

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

GATTGGATCTGGAATCAGATGCATATTGATGAAGAAAAAAACACCAGTCTGCCGCATCATGTGGGTAAAATTAAAAGCAGTGTGAGCCGCAAAAATGCAAAATATCTGCTGAAAGGTGAATATGTGGGTAAAGTGTTCCGCGTTGATGCAGAAACCGGTGATGTGTTCGCAATTGAACGTCTGGATCGTGAAAATATTAGTGAATATCATCTGACCGCAGTGATTGTTGATAAAGATACCGGTGAAAATCTGGAAACACCTAGTAGCTTCACCATTAAAGTGCATGATGTGAATGATAATTGGCCGGTGTTCACCCATCGTCTGTTCAATGCAAGCGTTCCGGAAAGTAGCGCCGTGGGTACCAGTGTTATTAGCGTTACCGCCGTTGATGCAGATGATCCGACCGTTGGTGATCATGCAAGTGTTATGTATCAGATTCTGAAAGGCAAAGAATACTTCGCCATTGATAATAGTGGTCGCATTATTACCATTACCAAAAGTCTGGATCGCGAAAAACAGGCCCGCTATGAAATTGTTGTGGAAGCACGTGATGCACAGGGCCTGCGCGGCGATAGTGGTACCGCAACCGTTCTGGTGACCCTGCAGGATATTAATGATAACTTCCCGTTCTTCACCCAGACCAAATATACCTTCGTGGTTCCGGAAGATACCCGCGTGGGCACCAGCGTGGGTAGCCTGTTCGTTGAAGATCCGGATGAACCGCAGAATCGTATGACCAAATATAGTATTCTGCGCGGTGATTATCAGGATGCCTTCACCATTGAAACCAATCCGGCACATAATGAAGGCATTATTAAACCGATGAAACCGCTGGATTATGAATATATTCAGCAGTATAGCTTCATCGTGGAAGCAACCGATCCGACCATTGATCTGCGCTATATGAGTCCGCCGGCCGGTAATCGTGCACAGGTTATTATTAATATTACCGATGTTGACGAGCCGCCGATCTTCCAGCAGCCGTTCTATCACTTCCAGCTGAAAGAAAATCAGAAAAAACCGCTGATTGGCACCGTTCTGGCCATGGATCCGGATGCAGCCCGTCATAGCATTGGTTATAGTATTCGTCGCACCAGCGATAAAGGTCAGTTCTTCCGCGTGACCAAAAAAGGCGATATCTATAATGAAAAGGAGCTGGATCGCGAGGTGTATCCGTGGTATAATCTGACCGTTGAAGCAAAAGAACTGGATAGTACCGGCACCCCGACCGGCAAAGAAAGCATTGTTCAGGTTCATATTGAAGTGCTGGATGAAAATGATAATGCACCGGAATTCGCCAAACCGTATCAGCCGAAAGTGTGTGAAAATGCAGTGCATGGTCAGCTGGTGCTGCAGATTAGCGCCATTGATAAAGATATTACCCCGCGTAATGTGAAATTCAAATTCATTCTGAACACCGAAAACAACTTCACCCTGACCGATAATCATGATAATACCGCAAATATTACCGTGAAATATGGCCAGTTCGATCGCGAACATACCAAAGTTCACTTCCTGCCGGTGGTGATTAGTGATAATGGCATGCCGAGCCGTACCGGCACCAGTACCCTGACCGTTGCCGTGTGCAAATGTAATGAACAGGGTGAATTCACCTTCTGTGAAGATATGGCAGCCCAGGTGGGCGTTAGTATTCAG

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~61kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

Cadherins are a superfamily of transmembrane glycoproteins that contain cadherin repeats of approximately 100 residues in their extracellular domain. Cadherins mediate calcium-dependent cell-cell adhesion and play critical roles in normal tissue development. The classic cadherin subfamily includes N-, P-, R-, B-, and E-cadherins, as well as about ten other members that are found in adherens junctions, a cellular structure near the apical surface of polarized epithelial cells. The cytoplasmic domain of classical cadherins interacts with β-catenin, γ-catenin (also called plakoglobin), and p120 catenin. β-catenin and γ-catenin associate with α-catenin, which links the cadherin-catenin complex to the actin cytoskeleton. While β- and γ-catenin play structural roles in the junctional complex, p120 regulates cadherin adhesive activity and trafficking. Investigators consider E-cadherin an active suppressor of invasion and growth of many epithelial cancers. Research studies indicate that cancer cells have upregulated N-cadherin in addition to loss of E-cadherin. This change in cadherin expression is called the "cadherin switch." N-cadherin cooperates with the FGF receptor, leading to overexpression of MMP-9 and cellular invasion. Research studies have shown that in endothelial cells, VE-cadherin signaling, expression, and localization correlate with vascular permeability and tumor angiogenesis. Investigators have also demonstrated that expression of P-cadherin, which is normally present in epithelial cells, is also altered in ovarian and other human cancers.

Note:

For research use only, not for use in diagnostic procedure.