Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

CD140a Recombinant Protein NCP0265

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

CAGCTGAGCCTGCCGAGTATTCTGCCGAATGAAAATGAAAAAGTTGTTCAGCTGAACAGTAGCTTCAGTCTGCGCTGCTTCGGTGAAAGCGAAGTTAGTTGGCAGTATCCGATGAGTGAAGAAGAAAGCAGCGATGTTGAAATTCGCAATGAAGAAAATAACAGCGGCCTGTTCGTTACCGTGCTGGAAGTGAGTAGTGCAAGTGCCGCACATACCGGTCTGTATACCTGCTATTATAATCATACCCAGACCGAAGAAAATGAACTGGAAGGTCGCCATATCTATATCTATGTTCCGGATCCGGATGTGGCATTCGTGCCGCTGGGTATGACCGATTATCTGGTTATTGTGGAAGATGATGATAGCGCAATTATTCCGTGCCGTACCACCGATCCGGAAACACCTGTTACCCTGCATAATAGTGAAGGTGTTGTTCCGGCCAGCTATGATAGTCGTCAGGGCTTCAATGGCACCTTCACCGTTGGCCCGTATATCTGTGAAGCAACCGTGAAAGGTAAAAAATTCCAGACCATTCCGTTCAATGTGTATGCCCTGAAAGCCACCAGTGAACTGGATCTGGAAATGGAAGCACTGAAAACCGTGTATAAAAGTGGCGAAACCATTGTTGTTACCTGCGCCGTGTTCAATAATGAAGTGGTGGATCTGCAGTGGACCTATCCGGGCGAAGTGAAAGGTAAGGGTATTACCATGCTGGAAGAAATTAAAGTGCCGAGCATTAAACTGGTGTATACCCTGACCGTTCCGGAAGCCACCGTTAAAGATAGTGGTGATTATGAATGTGCAGCACGTCAGGCCACCCGCGAAGTTAAAGAAATGAAAAAAGTGACCATCAGTGTTCATGAAAAAGGCTTCATTGAAATTAAGCCGACCTTCAGTCAGCTGGAAGCCGTTAATCTGCATGAAGTTAAACACTTCGTTGTGGAAGTTCGTGCATATCCGCCGCCGCGCATTAGCTGGCTGAAAAATAATCTGACCCTGATTGAAAATCTGACCGAAATTACCACCGATGTTGAAAAAATTCAGGAAATTCGTTACCGTAGTAAACTGAAACTGATTCGCGCCAAAGAAGAAGATAGCGGTCATTATACCATTGTTGCCCAGAATGAAGATGCCGTTAAAAGCTATACCTTCGAACTGCTGACCCAGGTGCCGAGCAGTATTCTGGATCTGGTGGATGATCATCATGGTAGCACCGGTGGCCAGACCGTTCGCTGTACCGCAGAAGGCACCCCGCTGCCGGATATTGAATGGATGATCTGTAAAGATATCAAGAAATGTAACAACGAGACCAGTTGGACCATTCTGGCCAATAATGTGAGTAATATTATCACCGAAATCCATAGTCGTGATCGTAGTACCGTTGAAGGTCGCGTTACCTTCGCAAAAGTGGAAGAAACCATTGCCGTGCGTTGCCTGGCCAAAAATCTGCTGGGCGCAGAAAATCGTGAACTGAAACTGGTTGCACCGACCCTGCGCAGCGAACTGACCGTTGCC

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~66kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

Platelet derived growth factor (PDGF) family proteins exist as several disulphide-bonded, dimeric isoforms (PDGF AA, PDGF AB, PDGF BB, PDGF CC, and PDGF DD) that bind in a specific pattern to two closely related receptor tyrosine kinases, PDGF receptor α (PDGFRα) and PDGF receptor β (PDGFRβ). PDGFRα and PDGFRβ share 75% to 85% sequence homology between their two intracellular kinase domains, while the kinase insert and carboxy-terminal tail regions display a lower level (27% to 28%) of homology. PDGFRα homodimers bind all PDGF isoforms except those containing PDGF D. PDGFRβ homodimers bind PDGF BB and DD isoforms, as well as the PDGF AB heterodimer. The heteromeric PDGF receptor α/β binds PDGF B, C, and D homodimers, as well as the PDGF AB heterodimer. PDGFRα and PDGFRβ can each form heterodimers with EGFR, which is also activated by PDGF. Various cells differ in the total number of receptors present and in the receptor subunit composition, which may account for responsive differences among cell types to PDGF binding. Ligand binding induces receptor dimerization and autophosphorylation, followed by binding and activation of cytoplasmic SH2 domain-containing signal transduction molecules, such as GRB2, Src, GAP, PI3 kinase, PLCγ, and NCK. A number of different signaling pathways are initiated by activated PDGF receptors and lead to control of cell growth, actin reorganization, migration, and differentiation. Tyr751 in the kinase-insert region of PDGFRβ is the docking site for PI3 kinase. Phosphorylated pentapeptides derived from Tyr751 of PDGFRβ (pTyr751-Val-Pro-Met-Leu) inhibit the association of the carboxy-terminal SH2 domain of the p85 subunit of PI3 kinase with PDGFR. Tyr740 is also required for PDGFRβ-mediated PI3 kinase activation.

Note:

For research use only, not for use in diagnostic procedure.