Host:

E.coli

Tag:

His-tag

AA Sequence:

CAGGTTGTTCAGGTGAATGATAGTATGTATGGCTTCATTGGTACCGATGTTGTTCTGCATTGCAGCTTCGCAAATCCGCTGCCGAGTGTGAAAATTACCCAGGTGACCTGGCAGAAAAGCACCAATGGCAGCAAACAGAATGTTGCAATCTATAATCCGAGTATGGGCGTGAGTGTGCTGGCCCCGTATCGTGAACGTGTGGAATTCCTGCGTCCGAGCTTCACCGATGGTACCATTCGTCTGAGTCGCCTGGAACTGGAAGATGAAGGTGTGTATATCTGTGAATTCGCAACCTTCCCGACCGGTAATCGTGAAAGCCAGCTGAATCTGACCGTGATGGCAAAACCGACCAATTGGATTGAAGGCACCCAGGCAGTGCTGCGTGCAAAAAAAGGCCAGGATGATAAAGTTCTGGTTGCCACCTGTACCAGTGCAAATGGCAAACCGCCGAGTGTGGTGAGCTGGGAAACCAGACTGAAAGGTGAAGCCGAATATCAGGAAATTCGCAATCCGAATGGCACCGTGACCGTGATTAGCCGCTATCGCCTGGTTCCGAGTCGCGAAGCCCATCAGCAGAGCCTGGCATGCATTGTGAATTATCACATGGATCGCTTCAAAGAAAGCCTGACCCTGAATGTGCAGTATGAACCGGAAGTTACCATTGAAGGCTTCGATGGCAATTGGTATCTGCAGCGCATGGATGTGAAACTGACCTGCAAAGCCGATGCAAATCCGCCGGCAACCGAATATCATTGGACCACCCTGAATGGTAGCCTGCCGAAAGGCGTGGAAGCACAGAATCGCACCCTGTTCTTCAAAGGTCCGATTAATTATAGCCTGGCCGGCACCTATATCTGTGAGGCAACCAATCCGATTGGTACCCGCAGTGGTCAGGTGGAAGTGAATATTACCGAATTCCCGTATACCCCGAGTCCGCCGGAACATGGCCGTCGTGCAGGTCCGGTTCCGACCGCA

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~36kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

Nectin is a Ca2+-independent homophilic cell adhesion molecule that belongs to the immunoglobulin superfamily. Human Nectin is identical to the poliovirus receptor-related protein (PRR) and is identified to be the α herpesvirus entry mediator. Nectin constitutes a family consisting of at least Nectin 1, 2 and 3. Nectin 2 and 3 are ubiquitously expressed, whereas Nectin 1 is abundantly expressed in the brain. Nectin 1 exists as Nectin 1α and 1β/HIgR, produced by alternative splicing. The cytoplasmic regions of Nectin 1α, but not Nectin 1β/ HIgR, have a C-terminal conserved motif (E/A-X-Y-V). This motif interacts with the PDZ domain of the F-Actin-binding protein, afadin, through which it is linked to the Actin cytoskeleton. Nectin 1, also designated HveC/ PRR1, allows the entry of herpes simplex virus type 1 (HSV-1) and HSV-2 into mammalian cells. The interaction of virus envelope glycoprotein D (gD) with Nectin 1 is an essential step in the process leading to membrane fusion; the gD binding site is located at the first Ig-like domain of Nectin 1. Both the transinteraction of Nectin and the interaction of Nectin with afadin are necessary for their co-localization with E-cadherin and catenins at adherens junctions.

Note:

For research use only, not for use in diagnostic procedure.