Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

CD110 Recombinant Protein NCP0246

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

CAGGATGTTAGTCTGCTGGCAAGTGATAGCGAACCGCTGAAATGCTTCAGTCGTACCTTCGAAGATCTGACCTGCTTCTGGGATGAAGAAGAAGCAGCACCGAGTGGCACCTATCAGCTGCTGTATGCATATCCGCGCGAAAAACCGCGTGCCTGCCCGCTGAGCAGTCAGAGCATGCCGCACTTCGGCACCCGTTATGTGTGCCAGTTCCCGGATCAGGAAGAAGTGCGCCTGTTCTTCCCGCTGCATCTGTGGGTTAAAAATGTGTTCCTGAATCAGACCCGTACCCAGCGTGTTCTGTTCGTTGATAGCGTGGGTCTGCCGGCCCCGCCGAGTATTATTAAAGCAATGGGCGGTAGTCAGCCGGGCGAACTGCAGATTAGCTGGGAAGAACCGGCACCGGAAATTAGTGACTTCCTGCGCTATGAACTGCGTTATGGTCCGCGCGATCCGAAAAATAGCACCGGCCCGACCGTTATTCAGCTGATTGCAACCGAAACCTGTTGCCCGGCCCTGCAGCGTCCGCATAGTGCAAGTGCCCTGGATCAGAGCCCGTGTGCCCAGCCGACCATGCCGTGGCAGGATGGCCCGAAACAGACCAGCCCGAGCCGTGAAGCCAGCGCACTGACCGCAGAAGGCGGCAGTTGTCTGATTAGCGGTCTGCAGCCGGGCAATAGTTATTGGCTGCAGCTGCGCAGCGAACCGGATGGTATTAGTCTGGGCGGCAGTTGGGGTAGTTGGAGTCTGCCGGTGACCGTGGATCTGCCGGGCGATGCAGTGGCACTGGGTCTGCAGTGCTTCACCCTGGATCTGAAAAATGTTACCTGCCAGTGGCAGCAGCAGGATCATGCCAGTAGCCAGGGCTTCTTCTATCATAGTCGCGCACGCTGCTGTCCGCGTGATCGCTATCCGATCTGGGAAAATTGCGAAGAAGAAGAAAAAACCAATCCGGGCCTGCAGACCCCGCAGTTCAGCCGTTGCCACTTCAAAAGCCGTAATGATAGCATTATTCATATCCTGGTTGAAGTTACCACCGCCCCGGGTACCGTTCATAGCTATCTGGGTAGCCCGTTCTGGATTCATCAGGCAGTTCGCCTGCCGACCCCGAATCTGCATTGGCGTGAAATTAGTAGCGGCCATCTGGAACTGGAATGGCAGCATCCGAGCAGTTGGGCCGCCCAGGAAACCTGCTATCAGCTGCGTTATACCGGCGAAGGTCATCAGGATTGGAAAGTTCTGGAACCGCCGCTGGGTGCCCGCGGTGGTACATTAGAACTGCGCCCGCGTAGCCGCTATCGCCTGCAGCTGCGTGCCCGTCTGAATGGTCCGACCTATCAGGGTCCGTGGAGCAGCTGGAGCGATCCGACCCGTGTTGAAACCGCCACCGAAACCGCCTGG

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~51kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

Thrombopoietin receptor (TPOR, c-Mpl) is a hematopoietic receptor that binds the growth factor, thrombopoietin (TPO), responsible for regulation of platelet production. Expression of TPOR by megakaryocytes is required for megakaryocyte growth and development. TPOR is also expressed by hematopoietic stem cells and is required for stem cell maintenance and expansion. Studies show that mice lacking either TPOR or TPO have severely reduced numbers of platelets and megakaryocytes as well as decreased numbers of other hematopoietic lineages. Binding of TPO to TPOR induces receptor dimerization that leads to phosphorylation and activation of the tyrosine kinase Jak2. Activated Jak2 associates with the cytoplasmic domain of TPOR and phosphorylates TPOR at Tyr626 and Tyr631. These phosphorylated tyrosine residues provide docking sites for downstream signaling molecules including Stat3, Stat5, Shc, and SHIP.

Note:

For research use only, not for use in diagnostic procedure.