Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

Integrin α5 (CD49e) Recombinant Protein NCP0244

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

CCTATTAACCCGAAAGGCCTGGAACTGGATCCGGAAGGTAGTCTGCATCATCAGCAGAAACGTGAAGCACCGAGTCGCAGTAGTGCCAGTAGCGGCCCGCAGATTCTGAAATGCCCGGAAGCCGAATGCTTCCGCCTGCGCTGTGAACTGGGCCCGCTGCATCAGCAGGAAAGCCAGAGCCTGCAGCTGCACTTCCGTGTGTGGGCAAAAACCTTCCTGCAGCGTGAACATCAGCCGTTCAGCCTGCAGTGCGAAGCAGTGTATAAAGCACTGAAAATGCCGTATCGTATTCTGCCGCGCCAGCTGCCGCAGAAAGAACGCCAGGTTGCAACCGCAGTGCAGTGGACCAAAGCAGAAGGCAGCTAT

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~16kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins with distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with the extracellular environment (inside-out signaling). Integrin α5/β1 is involved in multiple biological processes including embryonic development, angiogenesis and tumor metastasis. By interaction with its fibronectin ligand, α5/β1 transduces signals that regulate cell adhesion, migration, matrix assembly and cytoskeletal organization.

Note:

For research use only, not for use in diagnostic procedure.