Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

CD82 Recombinant Protein NCP0231

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

GGTAAACTGAAACAGGAAATGGGCGGTATTGTGACCGAACTGATTCGTGATTATAATAGTAGTCGCGAAGATAGCCTGCAGGATGCCTGGGATTATGTTCAGGCACAGGTGAAATGCTGCGGTTGGGTGAGCTTCTATAATTGGACCGATAATGCCGAACTGATGAATCGCCCGGAAGTGACCTATCCGTGTAGCTGTGAAGTTAAAGGCGAAGAAGATAATAGTCTGAGCGTGCGTAAAGGCTTCTGTGAAGCCCCGGGCAATCGCACCCAGAGTGGCAATCATCCGGAAGATTGGCCGGTGTATCAGGAAGGTTGTATGGAAAAAGTTCAGGCCTGGCTGCAGGAAAATCTG

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~15kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

CD82 (KAI1) belongs to the tetraspanin family, which is characterized by four transmembrane domains, one short extracellular domain (ECL1), and one long extracellular domain (ECL2). CD82 does not have enzymatic activity and appears to function by regulating the trafficking of other proteins and organization of the cell membrane. CD82 was originally described as a costimulator for T cells that directly associates with CD4 and CD8, and was subsequently identified during a screen as a metastasis suppressor in prostate cancer. CD82 has since been found to act as a metastasis suppressor in a variety of cancers, and its downregulation is associated with poor prognosis in research studies. CD82 suppresses metastasis through multiple mechanisms including inhibition of cell motility and invasion by modulating c-Met and the urokinase plasminogen activator surface receptor (uPAR), as well as promotion of homotypic cell-cell adhesion by stabilizing interactions between E-cadherin and β-catenin.

Note:

For research use only, not for use in diagnostic procedure.