Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

CD57 Recombinant Protein NCP0216

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

ACCCTGGCTCCGCTGCTGGCAGTTCATAAAGATGAAGGTAGTGATCCGCGTCGTGAAACACCTCCGGGTGCCGATCCGCGCGAATATTGCACCAGTGATCGCGATATTGTGGAAGTTGTGCGTACCGAATATGTGTATACCCGTCCGCCGCCGTGGAGTGATACCCTGCCGACCATTCATGTGGTTACCCCGACCTATAGTCGTCCGGTTCAGAAAGCAGAACTGACCCGTATGGCCAATACCCTGCTGCATGTTCCGAATCTGCATTGGCTGGTTGTGGAAGATGCCCCGCGCCGCACCCCGTTAACCGCTAGACTGCTGCGTGATACCGGTCTGAATTATACCCATCTGCATGTGGAAACACCTCGTAATTATAAACTGCGTGGCGATGCCCGTGATCCGCGTATTCCGCGCGGTACCATGCAGCGCAATCTGGCCCTGCGTTGGCTGCGTGAAACCTTCCCGCGTAATAGCAGCCAGCCGGGTGTGGTGTACTTCGCCGATGATGATAATACCTATAGTCTGGAACTGTTCGAAGAAATGCGTAGTACCCGTCGCGTTAGTGTGTGGCCGGTGGCATTCGTGGGCGGCCTGCGTTATGAAGCACCGCGCGTGAATGGTGCAGGTAAAGTTGTGGGCTGGAAAACCGTGTTCGATCCGCATCGCCCGTTCGCAATTGATATGGCCGGCTTCGCCGTGAATCTGCGTCTGATTCTGCAGCGTAGCCAGGCCTACTTCAAACTGCGTGGTGTTAAAGGTGGTTATCAGGAAAGCAGCCTGCTGCGCGAACTGGTTACCCTGAATGATCTGGAACCGAAAGCAGCCAATTGTACCAAAATTCTGGTGTGGCATACCCGTACCGAAAAACCGGTGCTGGTTAATGAAGGCAAAAAAGGCTTCACCGATCCGAGCGTGGAAATT

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~35kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

Galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 1 (B3GAT1), also known as beta-1,3-glucuronyltransferase 1 and glucuronosyltransferase P, is a type II membrane protein enzyme encoded by the B3GAT1 gene. This gene is localized on the 11q25 chromosome and is a member of the glucuronyltransferase gene family. B3GAT1 is one of the enzymes involved in the biosynthesis of carbohydrate epitope human natural killer-1 (HNK-1), also known as CD57 and Leu7. B3GAT1 catalyzes the glucuronyl transfer reaction that adds a glucuronic acid to the terminal N-acetyllactosamine (Lac) disaccharide to form the CD57 epitope on a variety of proteins, lipids, and chondroitin sulfate proteoglycans at the cell surface. CD57 is present on a subset of peripheral blood lymphocytes, including NK cells and CD8+ T cells, as well as neural cells and striated muscle. The CD57 epitope may play a role in neural cell adhesion, and characterizes unique maturation states in T and NK cells.

Note:

For research use only, not for use in diagnostic procedure.