Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

CD209 Recombinant Protein NCP0190

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

CAGGTGAGTAAAGTTCCGAGTAGCATTAGCCAGGAACAGAGTCGCCAGGATGCCATCTATCAGAATCTGACCCAGCTGAAAGCAGCAGTTGGCGAACTGAGTGAAAAAAGCAAACTGCAGGAAATCTATCAGGAACTGACCCAGTTAAAAGCAGCAGTGGGTGAACTGCCGGAAAAAAGCAAGCTGCAGGAAATCTATCAAGAACTGACCCGCCTGAAAGCCGCCGTTGGTGAACTGCCTGAAAAAAGCAAATTACAGGAAATCTATCAGGAGCTGACCTGGCTGAAAGCCGCGGTTGGCGAATTACCGGAAAAAAGTAAAATGCAGGAAATCTATCAGGAATTAACCCGCCTGAAGGCCGCAGTGGGCGAACTGCCGGAGAAAAGTAAACAGCAGGAAATCTATCAGGAACTTACCCGTCTGAAAGCAGCCGTGGGTGAATTACCGGAGAAAAGCAAACAGCAGGAGATCTATCAGGAACTGACACGCCTGAAAGCGGCCGTTGGTGAGCTGCCGGAAAAGAGCAAACAGCAAGAAATCTATCAGGAACTGACGCAGCTGAAAGCGGCAGTGGAACGTCTGTGCCATCCGTGTCCGTGGGAATGGACCTTCTTCCAGGGTAATTGCTACTTCATGAGCAATAGCCAGCGCAATTGGCATGATAGCATTACCGCCTGCAAAGAAGTTGGCGCACAGCTGGTTGTTATTAAAAGTGCAGAAGAACAGAACTTCCTGCAGCTGCAGAGTAGCCGTAGTAATCGCTTCACCTGGATGGGTCTGAGTGATCTGAATCAGGAAGGCACCTGGCAGTGGGTGGATGGCAGCCCGCTGCTGCCGAGCTTCAAACAGTATTGGAATCGCGGTGAACCGAATAATGTTGGTGAAGAAGATTGTGCAGAATTCAGCGGCAATGGTTGGAATGATGATAAATGTAATCTGGCCAAATTCTGGATCTGTAAAAAAAGTGCAGCCAGTTGCAGTCGCGATGAAGAACAGTTCCTGAGTCCGGCCCCGGCCACCCCTAATCCGCCTCCTGCT

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~38kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Background:

DC-SIGN (CD209, CLEC4L) is a C-type lectin receptor expressed by dendritic cells (DCs). The DC-SIGN transcript can undergo several splicing events to generate at least thirteen different transmembrane and soluble isoforms. DC-SIGN responds to a broad range of pathogens due to its ability to recognize both mannose and fructose carbohydrates, and is well studied for its role in HIV infection. Recognition of the HIV envelope glycoprotein gp120 by DC-SIGN leads to internalization of HIV by DCs and facilitates transmission of the virus to CD4+ T cells. DC-SIGN also mediates adhesion to T cells through interaction with ICAM-3, as well as transmigration across the endothelium by binding to ICAM-2. The DC-SIGN receptor can modulate TLR signaling by activating the kinase Raf-1. The closely related molecule DC-SIGNR (L-SIGN, CLEC4M) is 77% homologous to DC-SIGN and likely arose through a gene duplication event. Like DC-SIGN, DC-SIGNR binds mannose carbohydrates on the surface of pathogens. However, the expression patterns of the two receptors differ, as DC-SIGNR expression is restricted to endothelial cells of the liver, lymph node, and placenta. Murine cells contain a set of related molecules, SIGNR1-SIGNR8. Based on sequence analysis, there is no clear murine ortholog to human DC-SIGN, however SIGNR3 is the most functionally similar due to its ability to recognize both mannose and fructose structures.

Note:

For research use only, not for use in diagnostic procedure.