Skip to main content

Bioworld Technology

Bioworld

Bioworld Technology is manufacturer of over 15,000 highly purified Monoclonal and Polyclonal Antibodies, Peptides, Proteins, and other related Research Products. Their products are used in all biological fields. An important focus in research taking place today is in work investigating Signal transduction pathways, Cardiac markers, Neuroscience as well as Stem cell research. Bioworld Technology is committed to providing customers with innovative research tools and to helping scientists determine the mechanisms of cell function and disease.
Bioworld Technology is one of the leading phospho-antibody manufacturers. They have produced over 500 phospho-antibodies for AKT, AMPK, GSK, STAT pathways. The peptides corresponding to each phospho-antibody have also been listed to help scientists. 
All of their high quality antibodies, peptides and kits were tested in their own facility with original published pictures included. They have a commitment to customer service and offer 100% quality satisfaction. If our products do not match the results listed on the data sheet, we will help you to troubleshoot or refund for the full credit.
Bioworld Technology continues to manufacture product lines to the highest standards; and all of their scientists are dedicated to the mystery of the world of science.


www.bioworlde.com 

CD13 Recombinant Protein NCP0174

Picto_Bioworld.jpg


The add to cart button will appear once you select the values above

Specifications

500ug/1mg price = 500ug

Host:

E.coli

Tag:

His-tag

AA Sequence:

AACGATCTGTTCAGTACCAGCGGCAATGAATGGGTTCTGCTGAATCTGAATGTTACCGGCTATTATCGTGTGAATTATGATGAAGAAAACTGGCGCAAAATTCAGACCCAGCTGCAGCGTGATCATAGCGCCATTCCGGTGATTAATCGTGCCCAGATTATTAATGATGCCTTCAATCTGGCCAGCGCACATAAAGTTCCGGTGACCCTGGCACTGAATAATACCCTGTTCCTGATTGAAGAACGCCAGTATATGCCGTGGGAAGCAGCACTGAGTAGTCTGAGTTACTTCAAACTGATGTTCGATCGCAGTGAAGTGTATGGCCCGATGAAAAATTATCTGAAAAAACAGGTGACCCCGCTGTTCATTCACTTCCGTAATAATACCAATAACTGGCGTGAAATTCCGGAAAATCTGATGGATCAGTATAGCGAAGTGAATGCCATTAGTACCGCATGCAGCAATGGCGTGCCGGAATGTGAAGAAATGGTTAGCGGTCTGTTCAAACAGTGGATGGAAAATCCGAATAATAATCCGATTCATCCGAATCTGCGCAGCACCGTGTATTGCAATGCAATTGCACAGGGTGGCGAAGAAGAATGGGACTTCGCATGGGAACAGTTCCGTAATGCAACCCTGGTTAATGAAGCAGATAAACTGCGTGCCGCCCTGGCATGCAGCAAAGAACTGTGGATTCTGAATCGTTATCTGAGCTATACCCTGAATCCGGATCTGATTCGTAAACAGGATGCCACCAGTACCATTATTAGCATTACCAATAATGTGATCGGTCAGGGCCTGGTGTGGGACTTCGTGCAGAGCAATTGGAAAAAACTGTTCAATGATTACGGTGGCGGTAGCTTCAGCTTCAGTAATCTGATTCAGGCAGTTACCCGCCGCTTCAGTACCGAATATGAACTGCAGCAGCTGGAACAGTTCAAAAAAGATAATGAAGAAACCGGCTTCGGTAGTGGCACCCGTGCACTGGAACAGGCACTGGAAAAAACCAAAGCAAATATTAAATGGGTGAAGGAAAACAAAGAGGTTGTGCTGCAGTGGTTCACCGAAAATAGCAAA

Expression vector:

pet-22b(+)

Soluble:

PBS, 4M Urea, PH7.4

BiowMW:

~40kDa

Purification & Purity:

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage & Stability:

Store at 4°C short term. Aliquot and store at -22°C long term. Avoid freeze-thaw cycles.

Background:

Aminopeptidase N (APN, CD13) is a widely expressed, membrane-bound proteolytic enzyme that breaks down peptides during digestion, cleaves cell surface antigens during antigen presentation, and acts as a receptor for human viruses, including several coronaviruses. This multifunctional protein is implicated in the regulation of many biological processes, including angiogenesis, cell proliferation, cell migration, inflammation and immune response. APN was originally identified as the cell surface antigen CD13, which is expressed in myeloid lineage hematopoietic cells and myeloid leukemia. Identified substrates of aminopeptidase N include the angiotensin I-III peptide hormones, the opioid peptide met-enkephalin, and cytokines MCP-1 and MIP-1. Abnormal APN protein expression is seen in various forms of cancer, with high APN expression associated with poor survival in colon cancer and non-small cell lung cancer and silenced APN expression related to poor prognosis in prostate cancer.

Note:

For research use only, not for use in diagnostic procedure.